546 singletons
| AGI | Size | Family* | Description |
|---|---|---|---|
| AT1G01130 | 543 | 1* | Symbol: None | expressed protein, ; expression supported by MPSS |
| AT1G01210 | 616 | 2492 | Symbol: None | DNA-directed RNA polymerase III family protein, similar to SP:O13896 DNA-directed RNA polymerases III 12.5 kDa polypeptide (EC 2.7.7.6) {Schizosaccharomyces pombe}; contains Pfam profiles PF02150: RNA polymerases M/15 Kd subunit, PF01096: Transcription factor S-II (TFIIS) |
| AT1G02440 | 573 | 6* | Symbol: ATARFD1A | Gene encoding ADP-ribosylation factor and similar to other ARFs and ARF-like proteins. Members of this family are known to be essential for vesicle coating and uncoating and functions in GTP-binding. |
| AT1G02590 | 270 | 2496 | Symbol: None | aldehyde oxidase, putative, similar to aldehyde oxidase GB:BAA28630 GI:3172044 from (Arabidopsis thaliana) |
| AT1G02880 | 1361 | 2497 | Symbol: None | thiamin pyrophosphokinase, putative, similar to thiamin pyrophosphokinase (Mus musculus) gi:6468206:dbj:BAA87040 |
| AT1G02965 | 489 | 2498 | Symbol: None | expressed protein |
| AT1G03200 | 440 | 12 | Symbol: None | expressed protein |
| AT1G03230 | 1502 | 2499 | Symbol: None | extracellular dermal glycoprotein, putative / EDGP, putative, similar to extracellular dermal glycoprotein EDGP precursor (Daucus carota) GI:285741 |
| AT1G03240 | 473 | 2500 | Symbol: None | hypothetical protein |
| AT1G03420 | 893 | 5000 | Symbol: None | expressed protein, similar to gb:T45484, emb:Z30724, and emb:Z30531 |
| AT1G06145 | 1858 | 2502 | Symbol: None | similar to pentatricopeptide (PPR) repeat-containing protein [Arabidopsis thaliana] (TAIR:At5g66520.1); similar to putative pentatricopeptide (PPR) repeat-containing protein [Oryza sativa (japonica cultivar-group)] (GB:XP_450548.1); contains InterPro domain PPR repeat (InterPro:IPR002885) |
| AT1G08695 | 267 | 5002 | Symbol: SCRL3 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
| AT1G09245 | 455 | 5003 | Symbol: None | expressed protein |
| AT1G10417 | 771 | 5004 | Symbol: None | Encodes protein with unknown function whose expression is repressed by inoculation with Agrobacterium tumerifaciens. |
| AT1G13605 | 312 | 5005 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT1G13607 | 219 | 5006 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT1G13608 | 237 | 5007 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT1G13609 | 237 | 5008 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT1G13755 | 360 | 5009 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT1G14755 | 237 | 5010 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT1G15757 | 252 | 77 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT1G19080 | 851 | 5011 | Symbol: TTN10 | expressed protein |
| AT1G19160 | 663 | 2521 | Symbol: None | F-box family protein-related, contains weak hit to TIGRFAM TIGR01640 : F-box protein interaction domain |
| AT1G19394 | 284 | 5012 | Symbol: None | expressed protein |
| AT1G23240 | 759 | 2530* | Symbol: None | caleosin-related family protein, similar to caleosin GB:AAF13743 GI:6478218 from (Sesamum indicum); similar to Ca+2-binding EF hand protein GB:AAB71227 (Glycine max); contains Pfam profilePF05042: Caleosin related protein |
| AT1G23290 | 604 | 2531 | Symbol: RPL27A | 60S ribosomal protein L27A (RPL27aB), similar to 60S RIBOSOMAL PROTEIN L27A GB:P49637 GI:1710530 from (Arabidopsis thaliana) |
| AT1G24000 | 369 | 123* | Symbol: None | Bet v I allergen family protein, contains Pfam profile PF00407: Pathogenesis-related protein Bet v I family |
| AT1G24230 | 738 | 125 | Symbol: None | paired amphipathic helix repeat-containing protein, weak similarity to transcriptional co-repressor SIN3A (Drosophila melanogaster) GI:2570794; contains Pfam profile PF02671: Paired amphipathic helix repeat |
| AT1G26795 | 574 | 2544* | Symbol: None | self-incompatibility protein-related, similar to S3 self-incompatibility protein (Papaver rhoeas) GI:1107841 |
| AT1G26890 | 843 | 2547 | Symbol: None | expressed protein |
| AT1G27330 | 459 | 2548 | Symbol: None | expressed protein, similar to EST gb:AA650671 and gb:T20610 |
| AT1G27590 | 976 | 2550 | Symbol: None | expressed protein, similar to hypothetical protein GB:AAD45997 GI:5668770 from (Arabidopsis thaliana) |
| AT1G28335 | 246 | 5013 | Symbol: LCR31 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT1G29179 | 717 | 196 | Symbol: None | similar to DC1 domain-containing protein [Arabidopsis thaliana] (TAIR:At1g44020.1) |
| AT1G29550 | 955 | 2560 | Symbol: None | eukaryotic translation initiation factor 4E, putative / eIF-4E, putative / eIF4E, putative / mRNA cap-binding protein, putative, similar to SP:O23252 Eukaryotic translation initiation factor 4E (eIF-4E) (eIF4E) (mRNA cap-binding protein) (eIF-4F 25 kDa subunit) (eIF-4F P26 subunit) {Arabidopsis thaliana}; contains Pfam profile PF01652: Eukaryotic initiation factor 4E |
| AT1G29820 | 1872 | 2562* | Symbol: None | expressed protein |
| AT1G29910 | 1020 | 214 | Symbol: CAB3 | chlorophyll A-B binding protein 2, chloroplast / LHCII type I CAB-2 / CAB-140 (CAB2A), identical to SP:P04778 Chlorophyll A-B binding protein 2, chloroplast precursor (LHCII type I CAB-2) (CAB-140) (LHCP) {Arabidopsis thaliana} |
| AT1G29920 | 1176 | 215 | Symbol: CAB2 | chlorophyll A-B binding protein 165/180, chloroplast / LHCII type I CAB-165/180, identical to SP:P04777 Chlorophyll A-B binding protein 165/180, chloroplast precursor (LHCII type I CAB-165/180) (LHCP) {Arabidopsis thaliana}; similar to photosystem II type I chlorophyll a /b binding protein GI:16364 from (Arabidopsis thaliana) |
| AT1G30473 | 720 | 5014 | Symbol: None | similar to heavy-metal-associated domain-containing protein [Arabidopsis thaliana] (TAIR:At3g05220.1); contains InterPro domain Heavy metal binding (InterPro:IPR006191); contains InterPro domain Heavy metal transport/detoxification protein (InterPro:IPR006121) |
| AT1G31270 | 273 | 5015 | Symbol: None | hypothetical protein |
| AT1G31550 | 1195 | 222 | Symbol: None | GDSL-motif lipase, putative, similar to lipase (Arabidopsis thaliana) GI:1145627; contains InterPro Entry IPR001087 Lipolytic enzyme, G-D-S-L family |
| AT1G31772 | 303 | 5016 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT1G32880 | 552 | 2565 | Symbol: None | importin alpha-1 subunit, putative, similar to importin alpha-1 subunit (Karyopherin alpha-1 subunit, KAP alpha) (Arabidopsis thaliana) SWISS-PROT:Q96321 |
| AT1G34400 | 366 | 237 | Symbol: None | expressed protein |
| AT1G34460 | 1515 | 2574 | Symbol: None | cyclin, putative, strong similarity to cyclin (Arabidopsis thaliana) GI:1360646 |
| AT1G35030 | 651 | 2579* | Symbol: None | hypothetical protein |
| AT1G35435 | 249 | 5017 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT1G35537 | 246 | 2585 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT1G35617 | 366 | 2587 | Symbol: None | expressed protein |
| AT1G35630 | 1052 | 2588* | Symbol: None | protease-associated zinc finger (C3HC4-type RING finger) family protein, contains Pfam domain, PF02225: protease-associated (PA) domain and Pfam domain, PF00097: Zinc finger, C3HC4 type (RING finger); similar to ReMembR-H2 protein JR702 (Arabidopsis thaliana) gi:6942149:gb:AAF32326 |
| AT1G35663 | 321 | 2590 | Symbol: None | hypothetical protein |
| AT1G36280 | 1785 | 2594 | Symbol: None | adenylosuccinate lyase, putative / adenylosuccinase, putative, similar to SP:P25739 Adenylosuccinate lyase (EC 4.3.2.2) (Adenylosuccinase) {Escherichia coli}; contains Pfam profile PF00206: Lyase |
| AT1G36675 | 807 | 279 | Symbol: None | glycine-rich protein |
| AT1G36950 | 681 | 2597* | Symbol: None | zinc finger protein-related, contains similarity to zinc finger proteins (C3HC4-type RING finger) |
| AT1G38950 | 303 | 5019 | Symbol: None | hypothetical protein |
| AT1G43320 | 357 | 5021 | Symbol: None | hypothetical protein |
| AT1G43415 | 354 | 5022 | Symbol: None | hypothetical protein |
| AT1G43666 | 445 | 5023 | Symbol: None | lipid transfer protein-related |
| AT1G47540 | 419 | 2628 | Symbol: None | trypsin inhibitor, putative, similar to SP:P26780 Trypsin inhibitor 2 precursor (MTI-2) {Sinapis alba} |
| AT1G47603 | 1182 | 5026 | Symbol: ATPUP19 | pseudogene, similar to Hypothetical protein, blastp match of 28% identity and 9.8e-15 P-value to GP:24756874:gb:AAN64138.1::AC121489 Hypothetical protein {Oryza sativa (japonica cultivar-group)} |
| AT1G47680 | 315 | 346* | Symbol: None | hypothetical protein |
| AT1G48670 | 1578 | 355* | Symbol: None | auxin-responsive GH3 family protein, similar to auxin-responsive GH3 product (Glycine max) GI:18591; contains Pfam profile PF03321: GH3 auxin-responsive promoter |
| AT1G48742 | 172 | 5028 | Symbol: MIR157d | Encodes a microRNA. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: CTGACAGAAGATAGAGAGCAC |
| AT1G49435 | 216 | 358 | Symbol: LCR16 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT1G49940 | 837 | 2637 | Symbol: None | expressed protein, contains similarity to putative beta-9 tubulin protein GB:AAF40459 GI:7211988 from (Arabidopsis thaliana) |
| AT1G50060 | 618 | 2638 | Symbol: None | pathogenesis-related protein, putative, similar to prb-1b (Nicotiana tabacum) GI:19970; contains Pfam profile PF00188: SCP-like extracellular protein |
| AT1G50340 | 474 | 5029 | Symbol: None | invertase/pectin methylesterase inhibitor family protein, low similarity to SP:P83326 Pectinesterase inhibitor (Pectin methylesterase inhibitor) (PMEI) {Actinidia chinensis}; contains Pfam profile PF04043: Plant invertase/pectin methylesterase inhibitor |
| AT1G51010 | 516 | 2640 | Symbol: None | expressed protein |
| AT1G51370 | 1707 | 2642 | Symbol: None | F-box family protein, contains F-box domain Pfam:PF00646 |
| AT1G51430 | 893 | 374 | Symbol: None | expressed protein |
| AT1G51820 | 2658 | 376* | Symbol: None | leucine-rich repeat protein kinase, putative, similar to light repressible receptor protein kinase GI:1321686 from (Arabidopsis thaliana); contains leucine rich repeat (LRR) domains, Pfam:PF00560; contains protein kinase domain, Pfam:PF00069 |
| AT1G52440 | 630 | 2643* | Symbol: None | expressed protein |
| AT1G52905 | 498 | 5030 | Symbol: None | expressed protein |
| AT1G53570 | 2335 | 2646 | Symbol: MAP3KA | mitogen-activated protein kinase kinase kinase (MAPKKK), putative (MAP3Ka), identical to MEK kinase (MAP3Ka)(Arabidopsis thaliana) gi:4204912:gb:AAD10848 |
| AT1G53690 | 245 | 2648 | Symbol: None | DNA-directed RNA polymerases I, II, and III 7 kDa subunit, putative, similar to SP:P53803 DNA-directed RNA polymerases I, II, and III 7.0 kDa polypeptide (EC 2.7.7.6) (ABC10-alpha) (RPB7.0) (RPB10alpha) {Homo sapiens}; contains Pfam profile PF03604: DNA directed RNA polymerase, 7 kDa subunit |
| AT1G53980 | 276 | 2650 | Symbol: None | polyubiquitin-related, contains similarity to polyubiquitin GI:166336 from (Aglaothamnion neglectum) |
| AT1G54445 | 237 | 5031 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT1G54880 | 192 | 5032 | Symbol: None | hypothetical protein |
| AT1G56233 | 264 | 5033 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT1G56240 | 974 | 2660 | Symbol: ATPP2 B13 | SKP1 interacting partner 3-related, contains similarity to SKP1 interacting partner 3 GI:10716951 from (Arabidopsis thaliana) |
| AT1G56530 | 558 | 2661 | Symbol: None | hydroxyproline-rich glycoprotein family protein, contains proline-rich extensin domains, INTERPRO:IPR002965; |
| AT1G56553 | 255 | 410 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT1G57630 | 519 | 438* | Symbol: None | disease resistance protein (TIR class), putative, domain signature TIR exists, suggestive of a disease resistance protein. |
| AT1G58055 | 240 | 444 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT1G58235 | 225 | 2663 | Symbol: None | expressed protein |
| AT1G59790 | 1125 | 2665 | Symbol: None | cullin-related, low similarity to Hs-CUL-1 (Homo sapiens) GI:1381142 |
| AT1G59833 | 255 | 465 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT1G60983 | 270 | 480 | Symbol: SCRL8 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
| AT1G61180 | 3042 | 2673* | Symbol: None | disease resistance protein (CC-NBS-LRR class), putative, domain signature CC-NBS-LRR exists, suggestive of a disease resistance protein. |
| AT1G61275 | 175 | 5035 | Symbol: U12 | gi:22293600:emb:AJ505704.1:ATH505704 Arabidopsis thaliana U12 snRNA, partial |
| AT1G61450 | 357 | 5036 | Symbol: None | expressed protein, contains similarity to myosin II GI:1763303 from (Schizosaccharomyces pombe); expression supported by MPSS |
| AT1G61688 | 294 | 5037 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT1G62085 | 1386 | 2678 | Symbol: None | mitochondrial transcription termination factor family protein / mTERF family protein, contains Pfam profile PF02536: mTERF |
| AT1G62850 | 464 | 5038 | Symbol: None | expressed protein, similar to Immature colon carcinoma transcript 1 (Digestion substraction 1) (DS- 1) (Swiss-Prot:Q14197) (Homo sapiens) |
| AT1G63055 | 611 | 5039 | Symbol: None | expressed protein |
| AT1G64107 | 276 | 5040 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT1G64195 | 226 | 524 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT1G65113 | 279 | 5041 | Symbol: SCRL2 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
| AT1G65150 | 1312 | 2683 | Symbol: None | meprin and TRAF homology domain-containing protein / MATH domain-containing protein, similar to ubiquitin-specific protease 12 (Arabidopsis thaliana) GI:11993471; contains Pfam profile PF00917: MATH domain |
| AT1G65352 | 246 | 532 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT1G65550 | 1626 | 2685* | Symbol: None | xanthine/uracil permease family protein, contains Pfam profile: PF00860 permease family |
| AT1G66280 | 1870 | 542* | Symbol: None | glycosyl hydrolase family 1 protein, contains Pfam PF00232 : Glycosyl hydrolase family 1 domain; TIGRFAM TIGR01233: 6-phospho-beta-galactosidase; similar to beta-glucosidase 1 (GI:12043529) (Arabidopsis thaliana) |
| AT1G66290 | 1362 | 2689 | Symbol: None | F-box family protein, contains F-box domain Pfam:PF00646 |
| AT1G66300 | 1371 | 2690* | Symbol: None | F-box family protein, contains F-box domain Pfam:PF00646 |
| AT1G66320 | 1603 | 2691* | Symbol: None | F-box family protein, contains F-box domain Pfam:PF00646 |
| AT1G66700 | 1287 | 2694* | Symbol: None | S-adenosyl-L-methionine:carboxyl methyltransferase family protein, similar to defense-related protein cjs1 (Brassica carinata)(GI:14009292)(Mol Plant Pathol (2001) 2(3):159-169) |
| AT1G66720 | 1115 | 2695 | Symbol: None | S-adenosyl-L-methionine:carboxyl methyltransferase family protein, similar to defense-related protein cjs1 (Brassica carinata)(GI:14009292)(Mol Plant Pathol (2001) 2(3):159-169) |
| AT1G66725 | 303 | 555 | Symbol: MIR163 | Encodes a microRNA. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: TTGAAGAGGACTTGGAACTTCGAT |
| AT1G66790 | 183 | 2696 | Symbol: None | expressed protein |
| AT1G66950 | 4557 | 2697 | Symbol: None | ABC transporter family protein, similar to PDR5-like ABC transporter GI:1514643 from (Spirodela polyrhiza) |
| AT1G67400 | 1005 | 2699 | Symbol: None | similar to phagocytosis and cell motility protein ELMO1-related [Arabidopsis thaliana] (TAIR:At2g44770.1); similar to OSJNBb0038F03.14 [Oryza sativa (japonica cultivar-group)] (GB:XP_473390.1); contains InterPro domain Protein of unknown function DUF609 (InterPro:IPR006816) |
| AT1G68905 | 288 | 2700 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT1G68907 | 291 | 563 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT1G69828 | 225 | 573 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT1G70960 | 1110 | 2705 | Symbol: None | F-box family protein, contains Pfam PF00646: F-box domain; contains TIGRFAM TIGR01640: F-box protein interaction domain |
| AT1G71320 | 1179 | 2708 | Symbol: None | S locus F-box-related / SLF-related, contains F-box domain Pfam:PF00646; contains TIGRFAM TIGR01640: F-box protein interaction domain; similar to S locus F-box (SLF)-S2-like protein (GI:13161528) (Antirrhinum hispanicum) |
| AT1G72510 | 1381 | 2710* | Symbol: None | expressed protein |
| AT1G72910 | 1420 | 2711 | Symbol: None | disease resistance protein (TIR-NBS class), putative, domain signature TIR-NBS exists, suggestive of a disease resistance protein. |
| AT1G73687 | 182 | 2712* | Symbol: MIR159a | Encodes a microRNA. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: TTTGGATTGAAGGGAGCTCTA |
| AT1G75170 | 1784 | 2715 | Symbol: None | SEC14 cytosolic factor family protein / phosphoglyceride transfer family protein, similar to polyphosphoinositide binding protein Ssh1p (GI:2739044) {Glycine max}; similar to SEC14 cytosolic factor (Phosphatidylinositol/phosphatidylcholine transfer protein) (PI/PCTP) (SP:P24859) (Kluyveromyces lactis) and to SEC14 cytosolic factor (SP:P53989) (Candida glabrata) |
| AT1G75290 | 1140 | 2716 | Symbol: None | isoflavone reductase, putative, similar to SP:P52577 Isoflavone reductase homolog P3 (EC 1.3.1.-) {Arabidopsis thaliana}; contains Pfam profile PF02716: Isoflavone reductase |
| AT1G76954 | 213 | 5042 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT1G77093 | 237 | 5043 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT1G78355 | 450 | 2723 | Symbol: None | expressed protein |
| AT2G01905 | 2582 | 5044 | Symbol: None | expressed protein, contains InterPro domain Cyclin, N-terminal domain (InterPro:IPR006671) |
| AT2G02100 | 504 | 615 | Symbol: LCR69/PDF2.2 | plant defensin-fusion protein, putative (PDF2.2), plant defensin protein family member, personal communication, Bart Thomma (Bart.Thomma@agr.kuleuven.ac.be); similar to SWISS-PROT:O65740 |
| AT2G02130 | 496 | 616 | Symbol: LCR68/PDF2.3 | plant defensin-fusion protein, putative (PDF2.3), plant defensin protein family member, personal communication, Bart Thomma (Bart.Thomma@agr.kuleuven.ac.be) |
| AT2G02147 | 243 | 5045 | Symbol: LCR73 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT2G02390 | 878 | 2731 | Symbol: ATGSTZ1 | glutathione S-transferase zeta 1 (GSTZ1) (GST18), identical to SP:Q9ZVQ3:GTZ1_ARATH Glutathione S-transferase zeta-class 1 (EC 2.5.1.18) (AtGSTZ1) (Maleylacetone isomerase) (EC 5.2.1.-) (MAI) {Arabidopsis thaliana}; contains Pfam profiles PF02798: Glutathione S-transferase, N-terminal domain and PF00043:Glutathione S-transferase, C-terminal domain |
| AT2G02520 | 636 | 2732 | Symbol: None | expressed protein |
| AT2G03020 | 1117 | 2733* | Symbol: None | heat shock protein-related, Prosite PS00430: TonB-dependent receptor proteins signature 1; contains some similar to Small heat shock protein, chloroplast precursor (SP:P30222) {Petunia hybrida} |
| AT2G03937 | 180 | 635 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT2G04034 | 279 | 2737* | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT2G04045 | 336 | 2739 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT2G04425 | 306 | 5046 | Symbol: LCR82 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT2G04680 | 2070 | 2743 | Symbol: None | DC1 domain-containing protein, contains Pfam profile PF03107: DC1 domain |
| AT2G04830 | 502 | 2744 | Symbol: None | F-box family protein, similar to F-box protein family, AtFBX7 (GI:20197899) (Arabidopsis thaliana); confirmed by FLcDNA GI:16604421; contains uncharacterized Arabidoppsis domain shared by 33 Arabidopsis proteins |
| AT2G04970 | 2427 | 2745 | Symbol: None | hypothetical protein, similar to At2g15200, At1g32830, At2g14140, At3g30450, At4g03990, At5g34895, At3g47270, At2g02200 |
| AT2G05185 | 651 | 2751 | Symbol: None | expressed protein |
| AT2G05250 | 2839 | 2752 | Symbol: None | DNAJ heat shock N-terminal domain-containing protein, contains Pfam profile PF00226 DnaJ domain |
| AT2G05270 | 415 | 5048 | Symbol: None | expressed protein |
| AT2G05335 | 306 | 5049 | Symbol: SCRL15 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
| AT2G06090 | 408 | 5050 | Symbol: None | self-incompatibility protein-related, similar to S1 self-incompatibility protein (Papaver rhoeas) GI:452430 |
| AT2G06645 | 1247 | 2761 | Symbol: None | expressed protein |
| AT2G06983 | 264 | 5051 | Symbol: SCRL16 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
| AT2G07669 | 330 | 5052 | Symbol: None | expressed protein |
| AT2G07705 | 201 | 5053 | Symbol: None | expressed protein |
| AT2G07710 | 453 | 687* | Symbol: None | expressed protein |
| AT2G10450 | 249 | 2780 | Symbol: None | 14-3-3 protein, putative / grf15, putative, contains similarity to GF14 psi chain GI:166717, SP:P42644 from (Arabidopsis thaliana) |
| AT2G10535 | 252 | 5056 | Symbol: LCR29 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT2G10836 | 849 | 2784* | Symbol: None | expressed protein |
| AT2G10870 | 252 | 5057 | Symbol: None | expressed protein |
| AT2G10975 | 402 | 2785 | Symbol: None | expressed protein |
| AT2G12465 | 252 | 750* | Symbol: LCR50 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT2G12475 | 258 | 751 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT2G12905 | 219 | 5059 | Symbol: None | expressed protein |
| AT2G12935 | 444 | 5060 | Symbol: None | expressed protein |
| AT2G13430 | 543 | 762* | Symbol: None | expressed protein |
| AT2G13542 | 231 | 765 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT2G13960 | 757 | 2796 | Symbol: None | myb family transcription factor, contains PFAM profile: PF00249 myb-like DNA binding domain |
| AT2G14590 | 972 | 2802 | Symbol: None | hypothetical protein |
| AT2G14730 | 354 | 779 | Symbol: None | expressed protein |
| AT2G15090 | 1692 | 2806 | Symbol: None | fatty acid elongase, putative, similar to fatty acid elongase 1 (GI:881615) |
| AT2G15220 | 848 | 2807 | Symbol: None | secretory protein, putative, similar to NtPRp27 (Nicotiana tabacum) GI:5360263; contains Pfam profile PF04450: Plant Basic Secretory Protein |
| AT2G15360 | 379 | 787* | Symbol: None | expressed protein |
| AT2G15815 | 423 | 2813 | Symbol: None | expressed protein |
| AT2G16220 | 1224 | 796* | Symbol: None | F-box family protein |
| AT2G16330 | 702 | 2818* | Symbol: None | expressed protein, includes At2g06610, At5g28266, At3g42620, At4g07696, At2g06690, At2g16160, At2g05480, At2g12140, At1g45080, At2g16330 |
| AT2G16586 | 1002 | 2819 | Symbol: None | expressed protein |
| AT2G17442 | 413 | 5062 | Symbol: None | expressed protein |
| AT2G17723 | 267 | 5063 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT2G18610 | 261 | 2823 | Symbol: None | expressed protein |
| AT2G18810 | 705 | 2824 | Symbol: None | expressed protein, contains Pfam profile PF03754: Domain of unknown function (DUF313) |
| AT2G19290 | 228 | 2825 | Symbol: None | expressed protein |
| AT2G19802 | 401 | 2827 | Symbol: None | expressed protein |
| AT2G19893 | 225 | 5064 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT2G20150 | 282 | 5065 | Symbol: None | expressed protein, and genefinder |
| AT2G20463 | 276 | 2828 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT2G21465 | 243 | 814 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT2G21655 | 562 | 5066 | Symbol: None | expressed protein, contains Pfam PF05617: Arabidopsis thaliana protein of unknown function (DUF784) |
| AT2G22121 | 237 | 819* | Symbol: LCR35 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT2G22340 | 1077 | 5068 | Symbol: None | expressed protein |
| AT2G22805 | 261 | 826 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT2G22807 | 282 | 827 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT2G24617 | 315 | 2835 | Symbol: None | expressed protein |
| AT2G24780 | 325 | 2837 | Symbol: None | expressed protein |
| AT2G24870 | 357 | 843* | Symbol: None | self-incompatibility protein-related, similar to S3 self-incompatibility protein (Papaver rhoeas) GI:1107841 |
| AT2G25185 | 309 | 5071 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT2G25295 | 240 | 5072 | Symbol: LCR81 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT2G25344 | 240 | 3454 | Symbol: LCR14 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT2G26120 | 315 | 2844 | Symbol: None | glycine-rich protein |
| AT2G27145 | 240 | 5073 | Symbol: LCR9 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT2G27400 | 930 | 2849* | Symbol: TAS1A | Trans-acting siRNA1a primary transcript (TAS1a). Regulated by miR173. |
| AT2G27790 | 723 | 2850 | Symbol: None | expressed protein |
| AT2G27800 | 1284 | 2851 | Symbol: None | pentatricopeptide (PPR) repeat-containing protein, contains Pfam profile PF01535: PPR repeat |
| AT2G28020 | 359 | 2852* | Symbol: None | expressed protein |
| AT2G28405 | 252 | 3457 | Symbol: LCR32 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT2G29460 | 895 | 2856 | Symbol: ATGSTU4 | glutathione S-transferase, putative |
| AT2G29790 | 367 | 2857 | Symbol: None | expressed protein |
| AT2G30933 | 684 | 2858 | Symbol: None | similar to hypothetical protein [Arabidopsis thaliana] (TAIR:At1g29380.1); similar to putative glucanase [Oryza sativa (japonica cultivar-group)] (GB:XP_470316.1) |
| AT2G31953 | 261 | 2862 | Symbol: LCR76 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT2G32200 | 414 | 2863 | Symbol: None | expressed protein, similar to expressed protein [Arabidopsis thaliana] (TAIR:At2g32210.1) |
| AT2G32500 | 1004 | 5074 | Symbol: None | expressed protein |
| AT2G34123 | 246 | 5075 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT2G34185 | 336 | 5076 | Symbol: None | expressed protein |
| AT2G34655 | 910 | 5077 | Symbol: None | expressed protein |
| AT2G35750 | 462 | 913 | Symbol: None | expressed protein |
| AT2G35830 | 699 | 2870 | Symbol: None | expressed protein |
| AT2G36255 | 240 | 5078 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT2G36355 | 468 | 2871 | Symbol: None | similar to expressed protein [Arabidopsis thaliana] (TAIR:At2g27740.1); similar to unknown [Oryza sativa (japonica cultivar-group)] (GB:AAO72703.1); contains InterPro domain Protein of unknown function DUF662 (InterPro:IPR007033) |
| AT2G36680 | 941 | 2872 | Symbol: None | expressed protein |
| AT2G36724 | 399 | 5079 | Symbol: None | expressed protein |
| AT2G38210 | 679 | 2876 | Symbol: None | ethylene-responsive protein, putative, very strong similarity to ethylene-inducible protein HEVER SP:Q39963 from (Hevea brasiliensis) |
| AT2G38530 | 666 | 2878 | Symbol: LTP2 | nonspecific lipid transfer protein 2 (LTP2), identical to nonspecific lipid-transfer protein 2 from Arabidopsis thaliana (SP:Q9S7I3); contains Pfam protease inhibitor/seed storage/LTP family domain PF00234 |
| AT2G39675 | 990 | 2880* | Symbol: TAS1C | Trans-acting siRNA1c primary transcript (TAS1c). Gb: AY922999 |
| AT2G39681 | 1034 | 2881 | Symbol: None | Expressed gene. |
| AT2G40995 | 246 | 2885 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT2G41810 | 1207 | 2887 | Symbol: None | expressed protein, contains Pfam profile PF04862: Protein of unknown function, DUF642 |
| AT2G43660 | 471 | 2888 | Symbol: None | glycosyl hydrolase family protein 17, similar to glucan endo-1,3-beta-glucosidase precursor SP:P52409 from (Triticum aestivum); C terminal homology only |
| AT2G46440 | 2340 | 2891 | Symbol: ATCNGC11 | similar to cyclic nucleotide-regulated ion channel, putative (CNGC12) [Arabidopsis thaliana] (TAIR:At2g46450.1); similar to cyclic nucleotide-regulated ion channel / cyclic nucleotide-gated channel (CNGC3) [Arabidopsis thaliana] (TAIR:At2g46430.1); similar to cyclic nucleotide-regulated ion channel / cyclic nucleotide-gated channel (CNGC1) [Arabidopsis thaliana] (TAIR:At5g53130.1); similar to cyclic nucleotide-regulated ion channel (CNGC10) (ACBK1) [Arabidopsis thaliana] (TAIR:At1g01340.1); similar to cyclic nucleotide-regulated ion channel, putative (CNGC13) [Arabidopsis thaliana] (TAIR:At4g01010.1); similar to CNG10_ARATH Probable cyclic nucleotide-gated ion channel 10 (Cyclic nucleotide-and calmodulin-regulated ion channel 10) (CaM-regulated potassium ion channel) (GB:Q9LNJ0); contains InterPro domain IQ calmodulin-binding region (InterPro:IPR000048); contains InterPro domain Cyclic nucleotide-binding domain (InterPro:IPR000595) |
| AT2G46460 | 483 | 5080 | Symbol: None | hypothetical protein |
| AT3G02370 | 643 | 962 | Symbol: None | expressed protein, similar to expressed protein [Arabidopsis thaliana] (TAIR:At3g57360.1) |
| AT3G04903 | 264 | 5081 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT3G04943 | 246 | 2899 | Symbol: LCR41 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT3G04945 | 231 | 978 | Symbol: LCR18 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT3G05327 | 639 | 2901 | Symbol: None | similar to cyclin family protein [Arabidopsis thaliana] (TAIR:At3g21870.1); similar to PREG-like protein [Picea mariana] (GB:AAC32127.1); contains InterPro domain Cyclin, N-terminal domain (InterPro:IPR006671) |
| AT3G05727 | 243 | 2902 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT3G05770 | 1548 | 2903 | Symbol: None | expressed protein |
| AT3G05890 | 366 | 2904 | Symbol: RCI2B | hydrophobic protein (RCI2B) / low temperature and salt responsive protein (LTI6B), identical to SP:Q9ZNS6 Hydrophobic protein RCI2B (Low temperature and salt responsive protein LTI6B) {Arabidopsis thaliana} |
| AT3G06545 | 576 | 2905 | Symbol: None | hypothetical protein |
| AT3G06690 | 460 | 2907 | Symbol: None | acyl-CoA oxidase family, similar to acyl-CoA oxidase (Arabidopsis thaliana) GI:8515709, acyl-CoA oxidase ACX3 (Arabidopsis thaliana) GI:8163758; contains Pfam profile PF01756: Acyl-CoA oxidase |
| AT3G06985 | 213 | 5082 | Symbol: LCR44 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT3G07005 | 237 | 5083 | Symbol: LCR43 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT3G09750 | 388 | 2912 | Symbol: None | expressed protein |
| AT3G10090 | 440 | 2913 | Symbol: None | 40S ribosomal protein S28 (RPS28A), similar to ribosomal protein S28 GB:P34789 (Arabidopsis thaliana) |
| AT3G10195 | 246 | 5084 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT3G10845 | 1272 | 2916 | Symbol: None | RNA recognition motif (RRM)-containing protein, similar to SP:P42731 Polyadenylate-binding protein 2 (Poly(A) binding protein 2) (PABP 2) {Arabidopsis thaliana}; contains INTERPRO:IPR000504 RNA-binding region RNP-1 (RNA recognition motif) domain |
| AT3G11300 | 627 | 2917 | Symbol: None | expressed protein |
| AT3G11810 | 1236 | 2918 | Symbol: None | expressed protein |
| AT3G12345 | 776 | 5085 | Symbol: None | similar to immunophilin, putative / FKBP-type peptidyl-prolyl cis-trans isomerase, putative [Arabidopsis thaliana] (TAIR:At3g12340.1) |
| AT3G13403 | 174 | 5086 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT3G13405 | 191 | 5087 | Symbol: MIR169A | Encodes a microRNA that targets genes of the HAP2 gene family. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: CAGCCAAGGATGACTTGCCGA |
| AT3G13662 | 561 | 2922 | Symbol: None | disease resistance-responsive protein-related / dirigent protein-related, similar to pathogenesis-related protein (Pisum sativum) gi:4585273:gb:AAD25355; similar to dirigent protein (Forsythia x intermedia) gi:6694695:gb:AAF25358 |
| AT3G13855 | 916 | 2923* | Symbol: U6-26 | gi:16517:emb:X52528.1:ATSNU626 Arabidopsis thaliana U6-26 snRNA gene |
| AT3G14735 | 793 | 2927 | Symbol: U6-1 | gi:16516:emb:X52527.1:ATSNU61 Arabidopsis thaliana U6-1 snRNA gene |
| AT3G15230 | 177 | 2928 | Symbol: None | expressed protein |
| AT3G16530 | 1094 | 2932 | Symbol: None | legume lectin family protein, contains Pfam domain, PF00139: Legume lectins beta domain |
| AT3G18217 | 165 | 5088 | Symbol: MIR157c | Encodes a microRNA. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: TTGACAGAAGATAGAGAGCAC |
| AT3G18240 | 1590 | 2936 | Symbol: None | expressed protein |
| AT3G18960 | 847 | 2937 | Symbol: None | transcriptional factor B3 family protein, contains Pfam profile PF02362: B3 DNA binding domain |
| AT3G20600 | 891 | 2940 | Symbol: NDR1 | non-race specific disease resistance protein (NDR1), identical to non-race specific disease resistance protein (NDR1) GB:AF021346 (Arabidopsis thaliana) (Science 278 (5345), 1963-1965 (1997)) |
| AT3G21980 | 678 | 2944* | Symbol: None | receptor-like protein kinase-related, contains Pfam profile: PF01657 Domain of unknown function that is usually associated with protein kinase domain Pfam:PF00069; similar to receptor-like protein kinase homolog RK20-1 (GI:4530126) (Phaseolus vulgaris) |
| AT3G21990 | 937 | 2945* | Symbol: None | receptor-like protein kinase-related, contains Pfam profile: PF01657 Domain of unknown function that is usually associated with protein kinase domain Pfam:PF00069; similar to receptor-like protein kinase 5 (GI:13506747){Arabidopsis thaliana} |
| AT3G22230 | 631 | 2946 | Symbol: None | 60S ribosomal protein L27 (RPL27B), similar to 60S RIBOSOMAL PROTEIN L27 GB:P41101 from (Solanum tuberosum) |
| AT3G22720 | 1137 | 1063* | Symbol: None | F-box family protein, similar to F-box protein family, AtFBX9 (GI:20197985) (Arabidopsis thaliana); contains Pfam PF00646: F-box domain; contains TIGRFAM TIGR01640 : F-box protein interaction domain |
| AT3G23165 | 234 | 1064 | Symbol: LCR42 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT3G23715 | 288 | 1068 | Symbol: SCRL13 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
| AT3G23727 | 279 | 1069 | Symbol: SCRL12 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
| AT3G24065 | 408 | 1072 | Symbol: None | expressed protein, ; expression supported by MPSS |
| AT3G24068 | 402 | 2950 | Symbol: None | similar to self-incompatibility protein-related [Arabidopsis thaliana] (TAIR:At3g24060.1) |
| AT3G24480 | 1485 | 2954 | Symbol: None | leucine-rich repeat family protein / extensin family protein, similar to extensin-like protein (Lycopersicon esculentum) gi:5917664:gb:AAD55979; contains leucine-rich repeats, Pfam:PF00560; contains proline rich extensin domains, INTERPRO:IPR002965 |
| AT3G24513 | 258 | 2955* | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT3G25265 | 246 | 2957 | Symbol: LCR4 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT3G25597 | 483 | 5090 | Symbol: None | expressed protein |
| AT3G27120 | 1033 | 2960 | Symbol: None | spastin ATPase, putative, similar to SWISS-PROT:Q9QYY8 spastin (Fragment) (Mus musculus); contains Pfam domain, PF00004: ATPase, AAA family |
| AT3G27720 | 1482 | 2961 | Symbol: None | zinc finger protein-related, contains Pfam:PF01485 IBR domain |
| AT3G27830 | 928 | 2963* | Symbol: RPL12 A | 50S ribosomal protein L12-1, chloroplast (CL12-A), identical to ribosomal protein L12 GB:X68046 (Arabidopsis thaliana) (J. Biol. Chem. 269 (10), 7330-7336 (1994)) |
| AT3G27835 | 240 | 1119* | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT3G27900 | 735 | 1122 | Symbol: None | expressed protein |
| AT3G28260 | 174 | 5092 | Symbol: None | hypothetical protein |
| AT3G28310 | 312 | 2966 | Symbol: None | expressed protein, similar to At14a (TIGR_Ath1:At3g28290, TIGR_Ath1:At3g28300) (Arabidopsis thaliana) |
| AT3G28370 | 879 | 1126 | Symbol: None | expressed protein |
| AT3G29560 | 363 | 5094 | Symbol: None | expressed protein |
| AT3G29785 | 330 | 5095 | Symbol: None | hypothetical protein |
| AT3G29796 | 1392 | 5096* | Symbol: None | hypothetical protein |
| AT3G30730 | 204 | 2984 | Symbol: None | hypothetical protein |
| AT3G30840 | 177 | 5097 | Symbol: None | expressed protein |
| AT3G30841 | 1722 | 1176 | Symbol: None | 2,3-biphosphoglycerate-independent phosphoglycerate mutase-related / phosphoglyceromutase-related, contains weak similarity to 2,3-bisphosphoglycerate-independent phosphoglycerate mutase 1 (EC 5.4.2.1) (Phosphoglyceromutase 1) (BPG-independent PGAM 1) (aPGAM 1) (aPGAM-Mj1). (Swiss-Prot:Q59007) (Methanococcus jannaschii) |
| AT3G31350 | 501 | 2988 | Symbol: None | expressed protein |
| AT3G32100 | 240 | 1194 | Symbol: None | hypothetical protein |
| AT3G32270 | 630 | 1202 | Symbol: None | expressed protein, similar to putative replication protein A1 GB:AAC95163 GI:4006821 from (Arabidopsis thaliana) |
| AT3G32902 | 363 | 1208 | Symbol: None | expressed protein |
| AT3G33073 | 540 | 2998 | Symbol: None | expressed protein |
| AT3G33187 | 267 | 2999 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT3G42150 | 721 | 3001 | Symbol: None | expressed protein |
| AT3G42473 | 222 | 5103 | Symbol: LCR47 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT3G42700 | 663 | 3009 | Symbol: None | hypothetical protein |
| AT3G42940 | 582 | 3012 | Symbol: None | expressed protein |
| AT3G42990 | 390 | 3013 | Symbol: None | hypothetical protein |
| AT3G43083 | 237 | 5105 | Symbol: LCR33 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT3G43380 | 648 | 3017* | Symbol: None | expressed protein |
| AT3G43505 | 231 | 1258 | Symbol: LCR30 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT3G43528 | 246 | 5108 | Symbol: None | expressed protein |
| AT3G43580 | 615 | 1261 | Symbol: None | expressed protein |
| AT3G43682 | 453 | 5109 | Symbol: None | expressed protein |
| AT3G43863 | 756 | 3018 | Symbol: None | expressed protein |
| AT3G44140 | 216 | 5110 | Symbol: None | expressed protein |
| AT3G44440 | 225 | 5111 | Symbol: None | expressed protein |
| AT3G44755 | 450 | 1281 | Symbol: None | expressed protein |
| AT3G44935 | 333 | 3022 | Symbol: None | hypothetical protein |
| AT3G45093 | 243 | 1287 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT3G45350 | 876 | 3026* | Symbol: None | hypothetical protein, similar to At4g09400, At2g14330 |
| AT3G45577 | 357 | 3029 | Symbol: None | similar to tRNA-splicing endonuclease, putative [Arabidopsis thaliana] (TAIR:At5g60230.2) |
| AT3G46030 | 684 | 3032 | Symbol: None | histone H2B, putative, strong similarity to histone H2B Arabidopsis thaliana GI:2407802, Gossypium hirsutum SP:O22582, Lycopersicon esculentum GI:3021489; contains Pfam profile PF00125 Core histone H2A/H2B/H3/H4 |
| AT3G46360 | 594 | 3035 | Symbol: None | expressed protein |
| AT3G46880 | 462 | 3036 | Symbol: None | expressed protein, ; expression supported by MPSS |
| AT3G47750 | 2835 | 3040 | Symbol: ATATH3 | ABC transporter family protein, probable transport protein ABC-C, Homo sapiens, PIR2:S71363 |
| AT3G47965 | 513 | 5113 | Symbol: None | expressed protein |
| AT3G49010 | 873 | 3044 | Symbol: ATBBC1 | 60S ribosomal protein L13 (RPL13B) / breast basic conserved protein 1-related (BBC1) |
| AT3G49230 | 231 | 5114 | Symbol: None | expressed protein |
| AT3G50250 | 447 | 1329 | Symbol: None | expressed protein, predicted protein, Arabidopsis thaliana |
| AT3G50925 | 273 | 5115 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT3G54840 | 914 | 5116 | Symbol: ARA6 | Rab GTPase (ARA6), identical to small GTPase Ara6 (Arabidopsis thaliana) GI:13160603 |
| AT3G55677 | 594 | 5117 | Symbol: None | similar to expressed protein [Arabidopsis thaliana] (TAIR:At1g26799.1); similar to S3 self-incompatibility protein [Papaver rhoeas] (GB:CAA60579.1) |
| AT3G55710 | 1530 | 1356 | Symbol: None | UDP-glucoronosyl/UDP-glucosyl transferase family protein, contains Pfam profile: PF00201 UDP-glucoronosyl and UDP-glucosyl transferase |
| AT3G56890 | 660 | 1364 | Symbol: None | F-box family protein-related, predicted proteins - Arabidopsis thaliana; contains TIGRFAM TIGR01640: F-box protein interaction domain |
| AT3G57360 | 787 | 3051 | Symbol: None | expressed protein |
| AT3G57840 | 465 | 3053 | Symbol: None | self-incompatibility protein-related, similar to S1 self-incompatibility protein (Papaver rhoeas) GI:452430 |
| AT3G58130 | 1325 | 3054 | Symbol: None | N-acetylglucosaminyl-phosphatidylinositol de-N-acetylase-related, similar to SP:Q9Y2B2 N-acetylglucosaminyl-phosphatidylinositol de-N-acetylase (EC 3.5.1.-) (Phosphatidylinositol-glycan biosynthesis, class L protein) (PIG-L) {Homo sapiens} |
| AT3G59390 | 859 | 3056 | Symbol: None | expressed protein, protein CG15643 - Drosophila melanogaster, EMBL:AE003499 |
| AT3G60150 | 722 | 3057 | Symbol: None | similar to expressed protein [Arabidopsis thaliana] (TAIR:At2g44525.1); similar to MGC79777 protein [Xenopus tropicalis] (GB:AAH76703.1); contains InterPro domain Protein of unknown function DUF598 (InterPro:IPR006729) |
| AT3G60180 | 844 | 3058 | Symbol: None | uridylate kinase, putative / uridine monophosphate kinase, putative / UMP kinase, putative, similar to uridylate kinase (EC 2.7.4.-) (UK) (Uridine monophosphate kinase) (UMP kinase) (UMP/CMP kinase) (Swiss-Prot:O04905) (Arabidopsis thaliana) |
| AT3G60966 | 420 | 3059 | Symbol: None | similar to zinc finger (C3HC4-type RING finger) family protein [Arabidopsis thaliana] (TAIR:At1g35330.1); similar to hypothetical protein [Oryza sativa (japonica cultivar-group)] (GB:XP_464828.1); contains InterPro domain Zn-finger, RING (InterPro:IPR001841) |
| AT3G61172 | 225 | 5118 | Symbol: LCR8 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT3G61182 | 231 | 1390 | Symbol: LCR54 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT3G61898 | 288 | 5119 | Symbol: None | expressed protein |
| AT3G62470 | 2075 | 3064* | Symbol: None | pentatricopeptide (PPR) repeat-containing protein, contains Pfam profile PF01535: PPR repeat |
| AT4G00130 | 744 | 3066 | Symbol: None | hypothetical protein, contains Pfam profile PF04504: Protein of unknown function, DUF573 |
| AT4G00238 | 1395 | 3068* | Symbol: None | DNA-binding storekeeper protein-related, contains Pfam PF04504: Protein of unknown function, DUF573; similar to storekeeper protein GI:14268476 (Solanum tuberosum) |
| AT4G00380 | 2170 | 3069* | Symbol: None | XH/XS domain-containing protein / XS zinc finger domain-containing protein, contains Pfam domains PF03469: XH domain, PF03468: XS domain and PF03470: XS zinc finger domain |
| AT4G00920 | 945 | 1417 | Symbol: None | COP1-interacting protein-related, similar to COP1-interacting protein 4 (CIP4) (Arabidopsis thaliana) GI:13160646 |
| AT4G02733 | 906 | 3073 | Symbol: None | similar to F-box family protein [Arabidopsis thaliana] (TAIR:At4g02760.1); contains InterPro domain Cyclin-like F-box (InterPro:IPR001810) |
| AT4G03570 | 1044 | 1445 | Symbol: None | expressed protein |
| AT4G03680 | 492 | 1449 | Symbol: None | expressed protein |
| AT4G03930 | 1751 | 3076* | Symbol: None | pectin methylesterase, putative, similar to pectin methylesterase GI:1617588 from (Lycopersicon esculentum) |
| AT4G03950 | 834 | 3077 | Symbol: None | glucose-6-phosphate/phosphate translocator, putative, similar to glucose-6-phosphate/phosphate-translocator precursor (Pisum sativum) gi:2997591:gb:AAC08525 |
| AT4G04402 | 504 | 3083 | Symbol: None | two-component phosphorelay mediator, putative, similar to ATHP1 (Arabidopsis thaliana) GI:4156241, ATHP2 (Arabidopsis thaliana) GI:4156243 |
| AT4G04470 | 907 | 3084 | Symbol: PMP22 | peroxisomal membrane protein 22 kDa (PMP22), identical to peroxisomal membrane protein (Arabidopsis thaliana) gi:3980254:emb:CAA06834 |
| AT4G04580 | 501 | 5120 | Symbol: None | myb family transcription factor, contains Pfam profile: PF00249 myb-like DNA-binding domain |
| AT4G04635 | 855 | 3085 | Symbol: None | hypothetical protein |
| AT4G05210 | 900 | 3089 | Symbol: None | bacterial transferase hexapeptide repeat-containing protein, similar to SP:P32203 UDP-3-O-(3-hydroxymyristoyl) glucosamine N-acyltransferase (EC 2.3.1.-) {Yersinia enterocolitica}; contains Pfam profile PF00132: Bacterial transferase hexapeptide (three repeats) |
| AT4G06735 | 591 | 3098 | Symbol: None | expressed protein |
| AT4G06740 | 258 | 5122 | Symbol: None | hypothetical protein |
| AT4G07520 | 2205 | 3107 | Symbol: None | expressed protein, contains Pfam profile PF03384: Drosophila protein of unknown function, DUF287 |
| AT4G07524 | 213 | 3108 | Symbol: None | GTP-binding protein, putative, similar to GTP-binding protein (Pisum sativum) gi:303736:dbj:BAA02109 |
| AT4G07666 | 1029 | 1510 | Symbol: None | expressed protein |
| AT4G07868 | 405 | 5123 | Symbol: None | expressed protein |
| AT4G08028 | 246 | 1517 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT4G08039 | 210 | 5124 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT4G08360 | 457 | 3113 | Symbol: None | KOW domain-containing protein, contains Pfam PF00467: KOW motif |
| AT4G08485 | 261 | 1529 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT4G09090 | 423 | 1540 | Symbol: None | glycosyl hydrolase family protein 17, similar to glucan endo-1,3-beta-glucosidase precursor SP:P52409 from (Triticum aestivum) |
| AT4G09520 | 1652 | 3121 | Symbol: None | 2,3-biphosphoglycerate-independent phosphoglycerate mutase family protein / phosphoglyceromutase family protein, contains similarity to 2,3-bisphosphoglycerate-independent phosphoglycerate mutase 1 (EC 5.4.2.1) (Phosphoglyceromutase 1) (BPG-independent PGAM 1) (aPGAM 1) (aPGAM-Mj1). (Swiss-Prot:Q59007) (Methanococcus jannaschii); contains weak hit to Pfam profile PF01676: Metalloenzyme superfamily |
| AT4G09647 | 246 | 5125 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT4G09770 | 1098 | 3122 | Symbol: None | meprin and TRAF homology domain-containing protein / MATH domain-containing protein, low similarity to ubiquitin-specific protease 12 (Arabidopsis thaliana) GI:11993471; contains Pfam profile PF00917: MATH domain |
| AT4G09880 | 246 | 3455 | Symbol: None | hypothetical protein, F21E10.5 Arabidopsis thaliana BAC F21E10, PID:g3047086 |
| AT4G09984 | 258 | 5127 | Symbol: LCR34 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT4G10115 | 291 | 1558 | Symbol: SCRL20 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
| AT4G10457 | 279 | 1565 | Symbol: SCRL1 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
| AT4G10595 | 270 | 5128 | Symbol: LCR2 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT4G10603 | 264 | 5129 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT4G10767 | 330 | 1571 | Symbol: SCRL21 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
| AT4G11180 | 715 | 3126* | Symbol: None | disease resistance-responsive family protein / dirigent family protein, similar to dirigent protein (Thuja plicata) gi:6694699:gb:AAF25360; similar to pathogenesis-related protein (Pisum sativum) gi:4585273:gb:AAD25355 |
| AT4G11250 | 990 | 3128* | Symbol: None | MADS-box family protein, contains Pfam profile PF00319: SRF-type transcription factor (DNA-binding and dimerisation domain); MADS-box protein AGL52 |
| AT4G11370 | 710 | 3129 | Symbol: RHA1A | zinc finger (C3HC4-type RING finger) family protein, strong similarity to RING-H2 finger protein RHA1a (Arabidopsis thaliana) GI:3790554; contains Pfam profile PF00097: Zinc finger, C3HC4 type (RING finger) |
| AT4G11430 | 660 | 1584* | Symbol: None | hydroxyproline-rich glycoprotein family protein, contains proline-rich extensin domains, INTERPRO:IPR002965; related to hydroxyproline-rich glycoprotein (Phaseolus vulgaris) gi:169349:gb:AAA33765 |
| AT4G11485 | 309 | 3130 | Symbol: LCR11 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT4G12470 | 799 | 1596 | Symbol: None | protease inhibitor/seed storage/lipid transfer protein (LTP) family protein, similar to pEARLI 1 (Accession No. L43080): an Arabidopsis member of a conserved gene family (PGF95-099), Plant Physiol. 109 (4), 1497 (1995); contains Pfam protease inhibitor/seed storage/LTP family domain PF00234 |
| AT4G12545 | 660 | 3132 | Symbol: None | protease inhibitor/seed storage/lipid transfer protein (LTP) family protein, contains protease inhibitor/seed storage/LTP family domain, Pfam:PF00234 |
| AT4G12770 | 3243 | 3133 | Symbol: None | auxilin-related, low similarity to SP:Q27974 Auxilin {Bos taurus} |
| AT4G13955 | 285 | 3453 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT4G13968 | 270 | 5130 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT4G14096 | 1825 | 1610 | Symbol: None | F-box family protein, contains F-box domain Pfam:PF00646 |
| AT4G14272 | 243 | 1611 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT4G14305 | 736 | 5131 | Symbol: None | similar to peroxisomal membrane protein 22 kDa (PMP22) [Arabidopsis thaliana] (TAIR:At4g04470.1); similar to putative peroxisomal membrane protein 22 kDa [Oryza sativa (japonica cultivar-group)] (GB:XP_464744.1); contains InterPro domain Mpv17/PMP22 (InterPro:IPR007248) |
| AT4G14785 | 288 | 1615* | Symbol: SCRL23 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
| AT4G14819 | 315 | 3140 | Symbol: None | expressed protein, similar to expressed protein [Arabidopsis thaliana] (TAIR:At1g72510.1); similar to expressed protein [Arabidopsis thaliana] (TAIR:At1g72510.2); similar to hypothetical protein [Oryza sativa (japonica cultivar-group)] (GB:XP_469725.1) |
| AT4G15390 | 1482 | 3142 | Symbol: None | transferase family protein, similar to alcohol acyltransferase (Fragaria x ananassa)(GI:10121328)(PMID:10810141), deacetylvindoline 4-O-acetyltransferase (Catharanthus roseus)(GI:4091808)(PMID:9681034) |
| AT4G15630 | 839 | 3144 | Symbol: None | integral membrane family protein, contains TIGRFAM TIGR01569 : plant integral membrane protein TIGR01569; contains Pfam PF04535 : Domain of unknown function (DUF588) |
| AT4G15733 | 261 | 5132 | Symbol: SCRL11 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
| AT4G15990 | 408 | 3145 | Symbol: None | expressed protein |
| AT4G16015 | 1608 | 3146 | Symbol: None | DC1 domain-containing protein, contains Pfam profile PF03107: DC1 domain |
| AT4G16162 | 387 | 3147 | Symbol: None | similar to leucine-rich repeat family protein / protein kinase family protein [Arabidopsis thaliana] (TAIR:At3g14840.2); similar to Leucine Rich Repeat, putative [Oryza sativa (japonica cultivar-group)] (GB:AAX95021.1); contains InterPro domain Leucine-rich repeat, plant specific (InterPro:IPR007090); contains InterPro domain Leucine-rich repeat (InterPro:IPR001611) |
| AT4G16165 | 554 | 3148* | Symbol: None | Expressed protein |
| AT4G16215 | 372 | 5133 | Symbol: None | expressed protein |
| AT4G16295 | 456 | 5134 | Symbol: SPH1 | self-incompatibility protein-related, similar to self-incompatibility (Papaver nudicaule) GI:3097262 |
| AT4G17713 | 300 | 1635 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT4G18205 | 1411 | 3152* | Symbol: None | similar to purine permease family protein [Arabidopsis thaliana] (TAIR:At4g18210.1); similar to putative purine permease [Oryza sativa (japonica cultivar-group)] (GB:XP_467223.1); contains InterPro domain Protein of unknown function DUF250 (InterPro:IPR004853) |
| AT4G18501 | 330 | 3155 | Symbol: None | expressed protein |
| AT4G18823 | 225 | 5135 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT4G19035 | 255 | 3158 | Symbol: LCR7 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT4G19038 | 255 | 1649 | Symbol: LCR15 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT4G19240 | 1101 | 3159 | Symbol: None | expressed protein |
| AT4G19270 | 426 | 3160 | Symbol: None | expressed protein |
| AT4G20720 | 2493 | 3166 | Symbol: None | dentin sialophosphoprotein-related, contains weak similarity to dentin sialophosphoprotein precursor (Swiss-Prot:Q9NZW4) (Homo sapiens) |
| AT4G21250 | 1524 | 3168 | Symbol: None | expressed protein, contains Pfam profile: PF01925 domain of unknown function DUF81 |
| AT4G22105 | 264 | 1693* | Symbol: SCRL26 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
| AT4G22110 | 1391 | 3171 | Symbol: None | alcohol dehydrogenase, putative, similar to alcohol dehydrogenase ADH GI:7705214 from (Lycopersicon esculentum); contains Pfam zinc-binding dehydrogenase domain PF00107 |
| AT4G22212 | 582 | 3173 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT4G23713 | 170 | 3180 | Symbol: MIR319a | Encodes a microRNA. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: TTGGACTGAAGGGAGCTCCC |
| AT4G24975 | 408 | 5136 | Symbol: None | self-incompatibility protein-related, similar to S1 self-incompatibility protein (Papaver rhoeas) GI:452430 |
| AT4G25480 | 908 | 3182 | Symbol: DREB1A | encodes a member of the DREB subfamily A-1 of ERF/AP2 transcription factor family (CBF3). The protein contains one AP2 domain. There are six members in this subfamily, including CBF1, CBF2, and CBF3. This gene is involved in response to low temperature and abscisic acid. |
| AT4G26260 | 985 | 3183 | Symbol: MIOX4 | expressed protein, similar to myo-inositol oxygenase (Sus scrofa) gi:17432544:gb:AAL39076 |
| AT4G26380 | 3051 | 1716 | Symbol: None | DC1 domain-containing protein, contains Pfam profile PF03107: DC1 domain |
| AT4G26570 | 1058 | 3184 | Symbol: ATCBL3 | calcineurin B-like protein 3 (CBL3), identical to calcineurin B-like protein 3 (GI:22136404) (Arabidopsis thaliana) |
| AT4G27030 | 972 | 3185* | Symbol: None | expressed protein |
| AT4G27745 | 598 | 5137 | Symbol: None | similar to yippee family protein [Arabidopsis thaliana] (TAIR:At5g53940.1); similar to yippee-like 1 [Mus musculus] (GB:NP_075738.1); similar to hypothetical protein LOC445323 [Danio rerio] (GB:NP_001003780.1); similar to ENSANGP00000019801 [Anopheles gambiae str. PEST] (GB:XP_309944.2); similar to CG15309-PA [Drosophila melanogaster] (GB:NP_572609.1); similar to Yippee-like 3 [Danio rerio] (GB:AAH67578.1); contains InterPro domain Yippee-like protein (InterPro:IPR004910) |
| AT4G29033 | 246 | 5138 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT4G29273 | 234 | 3188 | Symbol: LCR23 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT4G29300 | 421 | 1739* | Symbol: LCR27 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT4G30064 | 237 | 1746* | Symbol: LCR61 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT4G30074 | 381 | 5139 | Symbol: LCR19 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT4G31940 | 1821 | 3194* | Symbol: CYP82C4 | cytochrome P450, putative, cytochrome P450 monooxygenase, Pisum sativum, PATCHX:G894153 |
| AT4G32110 | 539 | 3196 | Symbol: None | expressed protein |
| AT4G32717 | 270 | 3200 | Symbol: SCRL24 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
| AT4G33710 | 765 | 3202* | Symbol: None | pathogenesis-related protein, putative, similar to PR-1a protein (Nicotiana tabacum) GI:19944; contains Pfam profile PF00188: SCP-like extracellular protein |
| AT4G33865 | 439 | 1768* | Symbol: None | 40S ribosomal protein S29 (RPS29C) |
| AT4G33900 | 1140 | 3203 | Symbol: None | kelch repeat-containing F-box family protein, contains F-box domain Pfam:PF00646 and Kelch motif Pfam:PF01344 |
| AT4G34135 | 1764 | 1770 | Symbol: None | UDP-glucoronosyl/UDP-glucosyl transferase family protein, contains Pfam profile: PF00201 UDP-glucoronosyl and UDP-glucosyl transferase |
| AT4G35165 | 363 | 1777 | Symbol: None | expressed protein |
| AT4G35335 | 949 | 5140 | Symbol: None | nucleotide-sugar transporter family protein, similar to SP:O77592 UDP N-acetylglucosamine transporter (Golgi UDP-GlcNAc transporter) {Canis familiaris}, SP:P78382 CMP-sialic acid transporter {Homo sapiens}; contains Pfam profile PF04142: Nucleotide-sugar transporter |
| AT4G37925 | 840 | 5141 | Symbol: None | expressed protein, similar to hypothetical protein glr1522 [Gloeobacter violaceus PCC 7421] (GB:NP_924468.1) |
| AT4G38570 | 1507 | 3212 | Symbol: None | CDP-diacylglycerol--inositol 3-phosphatidyltransferase, putative / phosphatidylinositol synthase, putative, similar to phosphatidylinositol synthase (PIS1) - Arabidopsis thaliana, PID:e1313354 (gi:3367632) |
| AT4G39403 | 606 | 5142 | Symbol: PLS | Encodes a 36 amino acid polypeptide that is necessary for correct responses to cytokinins and auxins, correct cell expansion in the root, and for vascular patterning in the leaf. |
| AT4G39917 | 249 | 5143 | Symbol: LCR45 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT5G01080 | 555 | 1805 | Symbol: None | expressed protein, predicted protein, Arabidopsis thaliana |
| AT5G03710 | 246 | 5144 | Symbol: None | expressed protein |
| AT5G03795 | 1821 | 5145 | Symbol: None | similar to exostosin family protein [Arabidopsis thaliana] (TAIR:At3g07620.1); similar to EXO [Cucumis melo] (GB:AAU04753.1); contains InterPro domain Exostosin-like (InterPro:IPR004263) |
| AT5G06020 | 456 | 3224 | Symbol: None | self-incompatibility protein-related, similar to self-incompatibility (Papaver rhoeas) GI:3097260 |
| AT5G06030 | 453 | 3225 | Symbol: None | self-incompatibility protein-related, simlar to self-incompatibility (Papaver rhoeas) GI:3097260 |
| AT5G06043 | 369 | 3226 | Symbol: None | expressed protein |
| AT5G07010 | 1429 | 3227 | Symbol: None | sulfotransferase family protein, similar to steroid sulfotransferase 3 (Brassica napus) GI:3420008, steroid sulfotransferase 1 (Brassica napus) GI:3420004; contains Pfam profile PF00685: Sulfotransferase domain |
| AT5G07650 | 2448 | 1840 | Symbol: None | formin homology 2 domain-containing protein / FH2 domain-containing protein, contains formin homology 2 domain, Pfam:PF02128 |
| AT5G07860 | 1491 | 3228 | Symbol: None | transferase family protein, similar to anthranilate N-hydroxycinnamoyl/benzoyltransferase, Dianthus caryophyllus (gi:2239091); contains Pfam transferase family domain PF002458 |
| AT5G08505 | 240 | 5146 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT5G08670 | 1976 | 3230 | Symbol: None | ATP synthase beta chain 1, mitochondrial, identical to SP:P83483 ATP synthase beta chain 1, mitochondrial precursor (EC 3.6.3.14) {Arabidopsis thaliana}; strong similarity to SP:P17614 ATP synthase beta chain, mitochondrial precursor (EC 3.6.3.14) {Nicotiana plumbaginifolia}; contains Pfam profiles PF00006: ATP synthase alpha/beta family nucleotide-binding domain, PF00306: ATP synthase ab C terminal, PF02874: ATP synthase alpha/beta family beta-barrel domain; supporting cDNA gi:26452102:dbj:AK118538.1: |
| AT5G09500 | 652 | 3232 | Symbol: None | 40S ribosomal protein S15 (RPS15C), ribosomal protein S15 - Arabidopsis thaliana, EMBL:Z23161 |
| AT5G11170 | 1693 | 3236 | Symbol: None | DEAD/DEAH box helicase, putative (RH15), DEAD BOX RNA helicase RH15, Arabidopsis thaliana, EMBL:ATH010466 |
| AT5G11750 | 1060 | 3237 | Symbol: None | ribosomal protein L19 family protein, similar to plastid ribosomal protein L19 precursor (Spinacia oleracea) gi:7582403:gb:AAF64312 |
| AT5G15960 | 549 | 3243 | Symbol: KIN1 | stress-responsive protein (KIN1) / stress-induced protein (KIN1), identical to SP:P18612 Stress-induced KIN1 protein {Arabidopsis thaliana} |
| AT5G16453 | 267 | 5148 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT5G17140 | 339 | 5149 | Symbol: None | cysteine proteinase-related, low similarity to cysteine proteinase (Sitophilus zeamais) GI:2804262 |
| AT5G18380 | 710 | 3246 | Symbol: None | 40S ribosomal protein S16 (RPS16C) |
| AT5G18403 | 264 | 5150 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT5G18407 | 264 | 5151 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT5G19315 | 243 | 5152 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT5G19485 | 1371 | 5153 | Symbol: None | similar to eIF4-gamma/eIF5/eIF2-epsilon domain-containing protein [Arabidopsis thaliana] (TAIR:At3g02270.1); similar to PREDICTED: similar to Translation initiation factor eIF-2B gamma subunit (eIF-2B GDP-GTP exchange factor) [Gallus gallus] (GB:XP_422427.1); contains InterPro domain Nucleotidyl transferase (InterPro:IPR005835); contains InterPro domain Bacterial transferase hexapeptide repeat (InterPro:IPR001451) |
| AT5G19710 | 345 | 5154 | Symbol: None | hypothetical protein, HPt phosphotransmitter - Arabidopsis thaliana, EMBL:AB041766 |
| AT5G20460 | 153 | 3252 | Symbol: None | hypothetical protein |
| AT5G22960 | 573 | 3255 | Symbol: None | serine carboxypeptidase S10 family protein, similar to serine carboxypeptidase III (Precursor) (SP:P37891) (Oryza sativa) |
| AT5G23035 | 267 | 1901 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT5G23212 | 228 | 1902 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT5G23230 | 720 | 3256 | Symbol: None | isochorismatase hydrolase family protein, low similarity to SP:P45743 Isochorismatase (EC 3.3.2.1) (2,3 dihydro-2,3 dihydroxybenzoate synthase) (Superoxide-inducible protein 1) (SOI1) {Bacillus subtilis}; contains Pfam profile PF00857: isochorismatase family protein |
| AT5G23350 | 1020 | 3257 | Symbol: None | GRAM domain-containing protein / ABA-responsive protein-related, contains similarity to ABA-responsive protein in barley (GI:4103635) (Hordeum vulgare) (J. Exp. Bot. 50, 727-728 (1999); contains Pfam PF02893: GRAM domain |
| AT5G23830 | 734 | 3260* | Symbol: None | MD-2-related lipid recognition domain-containing protein / ML domain-containing protein, contains Pfam profile PF02221: ML domain |
| AT5G23840 | 816 | 3261* | Symbol: None | MD-2-related lipid recognition domain-containing protein / ML domain-containing protein, contains Pfam profile PF02221: ML domain |
| AT5G24220 | 1131 | 3264 | Symbol: None | lipase class 3-related |
| AT5G26020 | 726 | 5155 | Symbol: None | hypothetical protein |
| AT5G26300 | 1050 | 1924* | Symbol: None | meprin and TRAF homology domain-containing protein / MATH domain-containing protein, low similarity to ubiquitin-specific protease 12 (Arabidopsis thaliana) GI:11993471; contains Pfam profile PF00917: MATH domain |
| AT5G26622 | 888 | 3269 | Symbol: None | similar to beta-galactosidase, putative / lactase, putative [Arabidopsis thaliana] (TAIR:At2g04060.1) |
| AT5G26717 | 426 | 3271 | Symbol: None | hypothetical protein |
| AT5G26890 | 252 | 3272 | Symbol: None | hypothetical protein |
| AT5G26970 | 327 | 5156 | Symbol: None | expressed protein |
| AT5G27260 | 912 | 3274 | Symbol: None | hypothetical protein |
| AT5G27495 | 243 | 1938 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT5G27590 | 963 | 3275* | Symbol: None | expressed protein |
| AT5G28030 | 1215 | 3277 | Symbol: None | cysteine synthase, putative / O-acetylserine (thiol)-lyase, putative / O-acetylserine sulfhydrylase, putative, similar to O-acetylserine(thiol) lyase (Brassica juncea) GI:2245144; contains Pfam profile PF00291: Pyridoxal-phosphate dependent enzyme |
| AT5G28070 | 267 | 5158 | Symbol: None | hypothetical protein |
| AT5G28288 | 255 | 5159 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT5G28310 | 702 | 3278 | Symbol: None | oxidoreductase-related, low similarity to glyoxylate reductase from Thermococcus litoralis (gi:13515409) |
| AT5G28410 | 321 | 3285 | Symbol: None | hypothetical protein, DYNAMIN-LIKE PROTEIN- Arabidopsis thaliana, EMBL:L36939 |
| AT5G28450 | 522 | 3286 | Symbol: None | chlorophyll A-B binding protein, chloroplast, putative / LHCI type II CAB, putative, strong similarity to SP:P13869 Chlorophyll A-B binding protein, chloroplast precursor (LHCI type II CAB) {Petunia hybrida}; contains Pfam profile: PF00504 chlorophyll A-B binding protein |
| AT5G28790 | 306 | 5163 | Symbol: None | hypothetical protein |
| AT5G28800 | 357 | 5164 | Symbol: None | expressed protein, predicted protein, Arabidopsis thaliana |
| AT5G29576 | 249 | 5166 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT5G29602 | 420 | 3293 | Symbol: None | hypothetical protein |
| AT5G29613 | 354 | 5167 | Symbol: None | hypothetical protein |
| AT5G30495 | 825 | 3294 | Symbol: None | expressed protein |
| AT5G32605 | 1098 | 3295 | Symbol: None | hypothetical protein |
| AT5G34581 | 486 | 5171 | Symbol: None | hydroxyproline-rich glycoprotein family protein |
| AT5G34820 | 660 | 3297 | Symbol: None | expressed protein, predicted proteins - Arabidopsis thaliana |
| AT5G35195 | 177 | 5172 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT5G35300 | 309 | 5173 | Symbol: None | expressed protein |
| AT5G35475 | 411 | 3306 | Symbol: None | hypothetical protein, very low similarity to transposase (Ipomoea purpurea) GI:4063770 |
| AT5G35510 | 207 | 3307 | Symbol: None | expressed protein |
| AT5G35603 | 483 | 2016* | Symbol: None | expressed protein |
| AT5G36650 | 477 | 3314* | Symbol: None | hypothetical protein |
| AT5G36735 | 597 | 3319* | Symbol: None | hypothetical protein |
| AT5G36810 | 189 | 5174 | Symbol: None | hypothetical protein |
| AT5G36920 | 249 | 3321 | Symbol: None | expressed protein, predicted protein, Arabidopsis thaliana; expression supported by MPSS |
| AT5G37190 | 2631 | 2056 | Symbol: CIP4 | COP1-interacting protein 4 (CIP4), similar to COP1-interacting protein 4 (CIP4) (Arabidopsis thaliana) GI:13160646; supporting cDNA gi:13160645:dbj:AB036832.1:; |
| AT5G37473 | 222 | 2065 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT5G37474 | 243 | 2066 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT5G38160 | 442 | 2078* | Symbol: None | protease inhibitor/seed storage/lipid transfer protein (LTP) family protein, contains Pfam profile: PF00234 protease inhibitor/seed storage/LTP family |
| AT5G38440 | 402 | 5175 | Symbol: None | self-incompatibility protein-related, low similarity to self-incompatibility (Papaver nudicaule) GI:3097262, S3 self-incompatibility protein (Papaver rhoeas) GI:1107841 |
| AT5G39365 | 270 | 5176 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT5G40405 | 1839 | 3337 | Symbol: None | similar to pentatricopeptide (PPR) repeat-containing protein [Arabidopsis thaliana] (TAIR:At5g66520.1); similar to pentatricopeptide (PPR) repeat-containing protein-like [Oryza sativa (japonica cultivar-group)] (GB:NP_919101.1); contains InterPro domain PPR repeat (InterPro:IPR002885) |
| AT5G41505 | 738 | 5177 | Symbol: None | hypothetical protein |
| AT5G41663 | 170 | 2121 | Symbol: MIR319b | Encodes a microRNA. MicroRNAs are regulatory RNAs with a mature length of ~21-nucleotides that are processed from hairpin precursors by Dicer-like enzymes. MicroRNAs can negatively regulate gene expression by attenuating translation or by directing mRNA cleavage. Mature sequence: TTGGACTGAAGGGAGCTCCC |
| AT5G42110 | 171 | 5178 | Symbol: None | expressed protein |
| AT5G42146 | 414 | 5179 | Symbol: None | expressed protein, similar to expressed protein [Arabidopsis thaliana] (TAIR:At5g19875.1) |
| AT5G42223 | 255 | 5180 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT5G42500 | 691 | 3339* | Symbol: None | disease resistance-responsive family protein, similar to disease resistance response protein 206-d (Pisum sativum) gi:508844:gb:AAB18669 |
| AT5G42640 | 903 | 3341* | Symbol: None | zinc finger (C2H2 type) family protein, contains Pfam domain, PF00096: Zinc finger, C2H2 type |
| AT5G42965 | 390 | 3342 | Symbol: None | hypothetical protein |
| AT5G43401 | 270 | 2141 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT5G43480 | 246 | 2145 | Symbol: None | expressed protein |
| AT5G44440 | 1756 | 3350 | Symbol: None | FAD-binding domain-containing protein, similar to SP:P30986 reticuline oxidase precursor (Berberine-bridge-forming enzyme) (BBE) (Tetrahydroprotoberberine synthase) (Eschscholzia californica); contains PF01565 FAD binding domain |
| AT5G44470 | 327 | 5181 | Symbol: None | expressed protein |
| AT5G44973 | 240 | 5182 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT5G45573 | 588 | 2164 | Symbol: None | expressed protein |
| AT5G45875 | 282 | 5183 | Symbol: SCRL27 | Encodes a member of a family of small, secreted, cysteine rich proteins with sequence similarity to SCR (S locus cysteine-rich protein). |
| AT5G46315 | 912 | 2168 | Symbol: U6-29 | gi:16518:emb:X52529.1:ATSNU629 Arabidopsis thaliana U6-29 snRNA gene |
| AT5G46660 | 918 | 2172 | Symbol: None | CHP-rich zinc finger protein, putative, contains similarity to CHP-rich zinc finger protein |
| AT5G46873 | 216 | 2176 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT5G46877 | 264 | 2178 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT5G47175 | 237 | 2186 | Symbol: LCR3 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT5G47340 | 954 | 3361 | Symbol: None | palmitoyl protein thioesterase family protein |
| AT5G48543 | 270 | 3363 | Symbol: LCR1 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT5G48905 | 255 | 5184 | Symbol: LCR12 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT5G48945 | 276 | 5185 | Symbol: LCR46 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT5G48953 | 258 | 5186 | Symbol: LCR86 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT5G49090 | 351 | 5187 | Symbol: None | hypothetical protein |
| AT5G49850 | 2006 | 3368* | Symbol: None | jacalin lectin family protein, similar to myrosinase-binding protein homolog (Arabidopsis thaliana) GI:2997767; contains Pfam profile PF01419 jacalin-like lectin domain |
| AT5G50423 | 306 | 2203 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT5G51100 | 1016 | 3378 | Symbol: FSD2 | superoxide dismutase (Fe), putative / iron superoxide dismutase, putative, similar to Fe-superoxide dismutase precursor (Medicago sativa) gi:16974682:gb:AAL32441 |
| AT5G51545 | 715 | 5188 | Symbol: None | expressed protein |
| AT5G51845 | 222 | 2217 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT5G51870 | 624 | 3380 | Symbol: None | MADS-box protein (AGL71), contains Pfam profile PF00319: SRF-type transcription factor (DNA-binding and dimerisation domain) |
| AT5G52750 | 640 | 3382 | Symbol: None | heavy-metal-associated domain-containing protein, Pfam profile PF00403: Heavy-metal-associated domain |
| AT5G54067 | 381 | 3385* | Symbol: None | expressed protein, low similarity to VIVIPAROUS1 protein from (Triticum aestivum) GI:7801372, (Hordeum vulgare subsp. vulgare) GI:1730475 |
| AT5G54075 | 361 | 3386* | Symbol: U3D | gi:17672:emb:X58068.1:ATU3D A.thaliana U3D snRNA gene |
| AT5G54225 | 249 | 5189 | Symbol: LCR83 | Encodes a member of a family of small,secreted, cysteine rich protein with sequence similarity to the PCP (pollen coat protein) gene family. |
| AT5G55132 | 411 | 2246* | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT5G56000 | 2336 | 3388 | Symbol: None | heat shock protein 81-4 (HSP81-4), nearly identical to heat shock protein hsp81.4 (Arabidopsis thaliana) GI:1906828; contains Pfam profiles PF02518: ATPase, histidine kinase-, DNA gyrase B-, and HSP90-like domain protein, PF00183: Hsp90 protein |
| AT5G56368 | 282 | 5190 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT5G56369 | 282 | 5191 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT5G56795 | 1861 | 2253 | Symbol: MT1B | one of the five metallothioneins (MTs) genes identified in Arabidopsis. MTs are cysteine-rich proteins required for heavy metal tolerance. The MT1b gene, however, is indicated to be inactive. |
| AT5G57290 | 643 | 3390 | Symbol: None | 60S acidic ribosomal protein P3 (RPP3B) |
| AT5G58780 | 1086 | 3392 | Symbol: None | dehydrodolichyl diphosphate synthase, putative / DEDOL-PP synthase, putative, similar to GI:796076 |
| AT5G59300 | 597 | 3394 | Symbol: UBC7 | ubiquitin-conjugating enzyme 7 (UBC7), E2; identical to gi:992703, SP:P42747 |
| AT5G60553 | 240 | 5192 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT5G60805 | 321 | 5193 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT5G62623 | 267 | 2274 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT5G62627 | 246 | 2275 | Symbol: None | Encodes a defensin-like (DEFL) family protein. |
| AT5G62700 | 1741 | 3398 | Symbol: TUB3 | tubulin beta-2/beta-3 chain (TUB3), nearly identical to SP:P29512 Tubulin beta-2/beta-3 chain {Arabidopsis thaliana} |
*: this AGI is also represented by one or more GFT
last update: 2007-02-14